Comparison

DNAConverter vs ClipStack

Price, ratings, monetisation and update history for both apps, side by side — with what reviewers say about each.

Head to head
About

DNAConverter

Features
Read full description

Want to say something, but also… not really? This app lets you hide those feelings inside ATCG. If saying “thank you” directly feels awkward, or being honest feels too embarrassing, just convert your message into a DNA-style ATCG sequence with this app. ■Text → Nucleotide Sequence “Thank you” becomes something like TTTATCCATCATTCGCTCCGACAATGCTTCGGTGTT unnecessarily long and mysteriously meaningful! Send it to someone and they won’t understand a thing, but you can feel satisfied that you “expressed your gratitude.” ■Nucleotide Sequence → Text Even ATCG-only cryptic messages can be decoded back to the original text. Perfect for private “secret code” chats among friends. ■Features • Generates DNA-like sequences instantly, even though they mean nothing • Copy & paste into messaging apps for quick sharing • Decode mode for conversations only insiders can understand • Absolutely no biological meaning whatsoever Even the words you can’t say out loud might feel lighter when you hide them in ATCG.

About

ClipStack

This utility app saves copied text for later reuse, preventing you from losing important information. It offers features like quick recopying, pinning favorites, and organizing snippets into folders. Customize the appearance and support the developer with optional tips.

Highlights
  • Save and reuse copied text
  • Pin favorite phrases
  • Organize text by folder
  • Customize theme colors
  • Quick recopy with one tap
  • Duplicate entries move to top
Features
Read full description

“Wait... where did Grandma’s address go?” You copied it earlier to send to someone. Now you need it again—and it’s just… gone. No trace of it. Ever had a moment like that? ClipStack lets you save copied text so you can reuse it later— not just immediately, but when it truly matters. Recopy in a single tap Duplicate entries move to the top Pin your favorite phrases for quick access Customize the look with theme colors Tip the developer with a small “thank you” Perfect for situations like: Sending family addresses or contact info over and over Reusing Zoom links or templated replies Saving short thoughts or messages to revisit later Copying is convenient—but too temporary. And sometimes, in that fleeting piece of text, there’s a bit of care or a connection to someone that matters. This app exists to make sure you don’t lose the little things that matter. Key Features ◆ Save & reuse copied text ・Duplicate content moves to the top for better organization ・Clean, one-line list view ・Tap to instantly copy ◆ Manage templates ・Group by folder ・Perfect for work or personal use ◆ Theme color customization ・Set your favorite color to match your mood ◆ Tip feature ・Send a little “thanks” with coffee, donuts, or lunch If you've ever thought: “I need that text again—but it's already gone...” then ClipStack is here to help.

Screenshots

DNAConverter2 screens
ClipStack4 screens

Verdict

The call

The clearest difference is price: ClipStack at Free against DNAConverter's $0.99. ClipStack also leads on update cadence (every 2 days vs every 4 months) and iOS requirement (18.4 vs 26.0). DNAConverter's advantage is in-app purchases (none vs 3) and ads (none vs shown). On device support there is nothing between them.

Scored on Price · Rating · Positive reviews · Number of ratings · Update frequency · Ads · In-app purchases · Monetization · Best chart rank · Devices · Requires iOS

CostPrice · In-app purchases · Ads · Monetization

ClipStack is free to download; DNAConverter costs $0.99 up front. ClipStack sells 3 one-off in-app purchases. DNAConverter asks for nothing beyond the download.

UpkeepUpdate frequency

DNAConverter ships an update every 4 months, ClipStack every 2 days. The most recent releases landed on September 12, 2026 and June 5, 2026 respectively.

Scorecard5 real differences · 3 level
DNAConverter versus ClipStack: the parameters behind the verdict, then further details
ParameterDNAConverterClipStack
Price$0.99Free — better
Positive reviews—100.0% of reviews
Update frequencyEvery 4 monthsEvery 2 days — better
AdsNo — betterYes
In-app purchasesNo — betterYes
Monetization—Free with in-app purchases
DevicesiPhone, iPadiPhone, iPad
Requires iOS26.018.4 — better
Further details — not scored
Size1 MB14 MB
Age rating4+4+
Developermakoto amijimaHiroyuki Sonozuka

In-app purchases

None

DNAConverter

No in-app purchases

3 purchases

ClipStack

One-time3
  • Coffee$0.99
  • Donut$1.99
  • Lunch$2.99

Questions

Is DNAConverter free?
DNAConverter costs $0.99, with no in-app purchases.
Is ClipStack free?
ClipStack is free to download, with in-app purchases available.
Do DNAConverter or ClipStack have ads?
ClipStack shows ads; DNAConverter does not.
Which is updated more often, DNAConverter or ClipStack?
DNAConverter ships an update every 4 months, and ClipStack every 2 days. Most recently, DNAConverter was updated on September 12, 2026 and ClipStack on June 5, 2026.

Other comparisons