DNAConverter vs MathWallet

Want to say something, but also… not really? This app lets you hide those feelings inside ATCG. If saying “thank you” directly feels awkward, or being honest feels too embarrassing, just convert your message into a DNA-style ATCG sequence with this app. ■Text → Nucleotide Sequence “Thank you” becomes something like TTTATCCATCATTCGCTCCGACAATGCTTCGGTGTT unnecessarily long and mysteriously meaningful! Send it to someone and they won’t understand a thing, but you can feel satisfied that you “expressed your gratitude.” ■Nucleotide Sequence → Text Even ATCG-only cryptic messages can be decoded back to the original text. Perfect for private “secret code” chats among friends. ■Features • Generates DNA-like sequences instantly, even though they mean nothing • Copy & paste into messaging apps for quick sharing • Decode mode for conversations only insiders can understand • Absolutely no biological meaning whatsoever Even the words you can’t say out loud might feel lighter when you hide them in ATCG.

The Multichain Wallet for Web3 supports all EVM / Substrate / CosmosSDK based and other mainstream blockchains. EVM: Ethereum, BNBChain, Polygon, Optimistic Ethereum, Arbitrum, Moonbeam, Fantom, Avalanche, and more. Substrate: Polkadot, Kusama, Statemine, Acala, Bifrost, Parallel, ChainX, and more. CosmosSDK: CosmosHub, IRISnet, Secret Network, Kava, Band Protocol, and more. Mainstream: Bitcoin, Solana, Arweave, Filecoin, Flow, Tron, Near, and more. Features: - Create wallets in-app, allowing you to store, receive, and transfer tokens easily in a 'one-stop shop' experience with an up-to-date tutorial - Monitor your portfolio and track earnings from anywhere, plus earn rewards without leaving the wallet - Secure your assets with Private Keys, Mnemonic Phrases, and more If you'd like to learn more about our service or if you have any questions, you can find us at: Official Website: https://mathwallet.org Twitter: @Mathwallet