Change Calculator vs DNAConverter

Change Calculator tells you what to hand back, the moment you tap the cash you were given. Made for the market stall, the yard sale, the bake sale and the school fair: anywhere you take cash without a till. It also works the other way round, so you can check that the cashier got it right. HOW IT WORKS 1. Type the bill. 2. Tap the coins and notes the customer handed you. 3. Read the change. The app also shows which coins and notes to give back. WHAT'S IN THE DRAWER • Over 150 currencies, each with its real coins and notes. The app starts with the currency of your device; switch with one tap. • Hide the denominations you never see, so your drawer matches your stall. • Undo a wrong tap, reset for the next customer, haptic feedback on every tap. • Dark mode, and a layout made for iPad. • Works completely offline. PRIVACY No ads, no accounts, no analytics. Nothing is tracked and nothing leaves your device. CHANGE PRO A single optional purchase that supports development and removes the occasional upgrade prompt. Everything else is included for everyone.

Want to say something, but also… not really? This app lets you hide those feelings inside ATCG. If saying “thank you” directly feels awkward, or being honest feels too embarrassing, just convert your message into a DNA-style ATCG sequence with this app. ■Text → Nucleotide Sequence “Thank you” becomes something like TTTATCCATCATTCGCTCCGACAATGCTTCGGTGTT unnecessarily long and mysteriously meaningful! Send it to someone and they won’t understand a thing, but you can feel satisfied that you “expressed your gratitude.” ■Nucleotide Sequence → Text Even ATCG-only cryptic messages can be decoded back to the original text. Perfect for private “secret code” chats among friends. ■Features • Generates DNA-like sequences instantly, even though they mean nothing • Copy & paste into messaging apps for quick sharing • Decode mode for conversations only insiders can understand • Absolutely no biological meaning whatsoever Even the words you can’t say out loud might feel lighter when you hide them in ATCG.