Anchor Wallet vs DNAConverter

Anchor is a next-generation authenticator powered by blockchain technology. Login, sign documents, and execute distributed smart contracts with the ease and convenience you would expect from a centralized solution. Gone are the days where only the most tech-savvy can utilize the decentralized power of blockchains. Anchor stores your private keys with military grade encryption using the secure enclave tied to your biometric information. This makes it simple for you to sign while making it impossible for hackers to get your keys. Simple, but still powerful. Use Anchor to login to your favorite website or sign a transaction that executes a smart contract that summons a robotaxi to your location. Whatever the EOSIO blockchain can do, Anchor can too. Supported EOSIO networks: • EOS • WAX • Telos • Proton • FIO Anchor Wallet is a Greymass project. Connect with us on Twitter @greymass or visit https://greymass.com

Want to say something, but also… not really? This app lets you hide those feelings inside ATCG. If saying “thank you” directly feels awkward, or being honest feels too embarrassing, just convert your message into a DNA-style ATCG sequence with this app. ■Text → Nucleotide Sequence “Thank you” becomes something like TTTATCCATCATTCGCTCCGACAATGCTTCGGTGTT unnecessarily long and mysteriously meaningful! Send it to someone and they won’t understand a thing, but you can feel satisfied that you “expressed your gratitude.” ■Nucleotide Sequence → Text Even ATCG-only cryptic messages can be decoded back to the original text. Perfect for private “secret code” chats among friends. ■Features • Generates DNA-like sequences instantly, even though they mean nothing • Copy & paste into messaging apps for quick sharing • Decode mode for conversations only insiders can understand • Absolutely no biological meaning whatsoever Even the words you can’t say out loud might feel lighter when you hide them in ATCG.