DNAConverter vs Polygon ID

Want to say something, but also… not really? This app lets you hide those feelings inside ATCG. If saying “thank you” directly feels awkward, or being honest feels too embarrassing, just convert your message into a DNA-style ATCG sequence with this app. ■Text → Nucleotide Sequence “Thank you” becomes something like TTTATCCATCATTCGCTCCGACAATGCTTCGGTGTT unnecessarily long and mysteriously meaningful! Send it to someone and they won’t understand a thing, but you can feel satisfied that you “expressed your gratitude.” ■Nucleotide Sequence → Text Even ATCG-only cryptic messages can be decoded back to the original text. Perfect for private “secret code” chats among friends. ■Features • Generates DNA-like sequences instantly, even though they mean nothing • Copy & paste into messaging apps for quick sharing • Decode mode for conversations only insiders can understand • Absolutely no biological meaning whatsoever Even the words you can’t say out loud might feel lighter when you hide them in ATCG.

Polygon ID enables you to create and manage your own self-sovereign digital identity. Prove your access rights and reputation without revealing any of your personal information. Manage verifiable claims about your identity and generate private proofs for digital interactions. Polygon ID is an open-source and private by default identity system based on zero-knowledge cryptography (zkSNARK). With the Polygon ID app, you will have access to web3 and web2 services and the ability for private on-chain verifications. Convenient control: - Secure authentication with biometrics or a 6-digit PIN - Identity recovery with seed phrase mechanism Obtaining claims: - Scan an issuer’s QR code - Follow the steps to connect your identity with the issuer and retrieve your claims - Store and manage your claims from your wallet Presenting your private proofs: - Scan a verifier’s QR code - Accept the proof request presented in your wallet - Generate and share the private proof of your claims with the verifier.