Tone generator vs DNAConverter

Generate various periodic signals with different waveforms with adjustable frequency and amplitude. These are used to test electronic circuits such as amplifiers and filters. Also suitable for musicians to tune their instruments. As soon as a note sounds, the integrated tuner recognizes the pitch and displays the note name and deviation. For any instrument that produces an even tone. A metronome also helps you to practise. Drive insects away or compare your hearing ability with your friends and relatives and share your results! Or watch others straining their ears to find the sounds that cannot locate you. Party fun is guaranteed! optional features (Purchase): - free of Ads - manual frequency input - support app functionality for connected Bluetooth devices, e.g. speaker - different signals - white/pink noise - tuner for tuning instruments (real-time tone recognition C1-C8) with tuning whistle - metronome for a steady tempo - note/tone for frequency - Left/right channel, stereo - create a tone sequence for playing several different frequencies in particular time slot - loop for tone sequence - save and delete tone sequences - load saved tone sequences - send your tone sequence as an audio file (.caf format) - option to compress audio files Attention: If you want to share your results with others, first test your audible frequencies, then mark under the speakers your lowest audible tone and your highest audible tone (stored only temporarily). A small hint: the chart will show you what other frequencies of your age are still possible to reach.

Want to say something, but also… not really? This app lets you hide those feelings inside ATCG. If saying “thank you” directly feels awkward, or being honest feels too embarrassing, just convert your message into a DNA-style ATCG sequence with this app. ■Text → Nucleotide Sequence “Thank you” becomes something like TTTATCCATCATTCGCTCCGACAATGCTTCGGTGTT unnecessarily long and mysteriously meaningful! Send it to someone and they won’t understand a thing, but you can feel satisfied that you “expressed your gratitude.” ■Nucleotide Sequence → Text Even ATCG-only cryptic messages can be decoded back to the original text. Perfect for private “secret code” chats among friends. ■Features • Generates DNA-like sequences instantly, even though they mean nothing • Copy & paste into messaging apps for quick sharing • Decode mode for conversations only insiders can understand • Absolutely no biological meaning whatsoever Even the words you can’t say out loud might feel lighter when you hide them in ATCG.