GPX Builder vs DNAConverter

*Continued use of GPS running in the background can dramatically decrease battery life. Developing apps that require location services can be a challenge when the data you receive in the simulator is so much different than what a device receives in the real world. Are your location settings battery friendly enough to solve the problem you are working on or could you do with a little less accuracy? GPX Builder allows you to adjust the settings of the location services to match your project, then record real location data as you create your own test routes for your simulator. You can name each route and email the GPX data back to your development team. We now include carrier and connectivity data so you can generate GPX or GeoJSON files with real world data for unreliable connectivity. We hope this will help you to understand your user's experience better so you can create amazing features. You can export your location data as a GPX file or in GeoJSON format. Points are recorded at a rate of one per second to match the playback speed of the iOS Simulator and give more realistic results when simulating location data. You can still record raw data only by choosing that option in the settings.

Want to say something, but also… not really? This app lets you hide those feelings inside ATCG. If saying “thank you” directly feels awkward, or being honest feels too embarrassing, just convert your message into a DNA-style ATCG sequence with this app. ■Text → Nucleotide Sequence “Thank you” becomes something like TTTATCCATCATTCGCTCCGACAATGCTTCGGTGTT unnecessarily long and mysteriously meaningful! Send it to someone and they won’t understand a thing, but you can feel satisfied that you “expressed your gratitude.” ■Nucleotide Sequence → Text Even ATCG-only cryptic messages can be decoded back to the original text. Perfect for private “secret code” chats among friends. ■Features • Generates DNA-like sequences instantly, even though they mean nothing • Copy & paste into messaging apps for quick sharing • Decode mode for conversations only insiders can understand • Absolutely no biological meaning whatsoever Even the words you can’t say out loud might feel lighter when you hide them in ATCG.